| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--22.6, 17.1, 8.4, 2.8, 0.98, 0.60; EcoRI/HindIII--22.6, 13.0, 4.7, 3.8, 2.05, 1.7 (doublet), 0.94, 0.90, 0.6, 0.26. Verified to contain the correct insert sequence using the following oligonucleotides (5'-3'): TGGGAAATTGTTATCTCATCGCT and GGGTTTCTCTCCAGTGTGAGTCCT. The predicted product size is (bp): 151. The observed product size is (bp): 147. |
| References |
Bray P, et al. Characterization and mapping of human genes encoding zinc finger proteins. Proc. Natl. Acad. Sci. USA 88: 9563-9567, 1991. PubMed: 1946370
Lichter P, et al. Clustering of C2-H2 zinc finger motif sequences within telomeric and fragile site regions of human chromosomes. Genomics 13: 999-1007, 1992. PubMed: 1505991
|
